Description:
                                                    
                                                    
                                                         
                                                            
                                                            HTT-Q72-PCDNA3.1, 1-90, K6Q K9Q K15Q 
                                                            
                                                    
                                                 
                                                
                                                
                                                
                                                
                                             
                                         
                                     
                                    
                                        
                                            
                                            
                                            
                                            
                                                
                                                    
                                                        
                                                            
                                                            
                                                                
                                                                    
                                                                        | 
                                                                            Repository
                                                                         | 
                                                                        
                                                                            HD Community Biorepository
                                                                         | 
                                                                     
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
	| Quantity | 
	20 µg | 
 
	| Quantitation Method | 
	Please see our FAQ | 
 
	| Certain Third Party Licensing Requirements | 
	Invitrogen License for Cat# V790.20 | 
 
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                    
                                                                        | 
                                                                            Alias
                                                                         | 
                                                                        
                                                                            Htt-Q72-pcDNA3.1, 1-90, K6Q K9Q K15Q
                                                                         | 
                                                                     
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
	| 
                                                                            Family History
                                                                         | 
	
                                                                            N
                                                                         | 
 
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                               
                                                                
                                                                
                                                                
                                                                    
                                                                        | 
                                                                            Remarks
                                                                         | 
                                                                        
                                                                            
                                                                         | 
                                                                     
                                                                
                                                                    
                                                                
                                                                
                                                                
                                                             
                                                         
                                                     
                                                 
                                                
                                                    
                                                        
                                                            
                                                            
                                                                
	| Remarks | 
	DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 72 polyglutamine repeats and K6Q, K9Q, K15Q mutations | 
 
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
                                                                
	| Construct Name | 
	Htt-Q72-pcDNA3.1, 1-90, K6Q K9Q K15Q | 
 
	| Insert Length | 
	450 | 
 
	| Vector | 
	pcDNA3.1 | 
 
	| Concentration | 
	785 ng/mL | 
 
	| Sequence | 
	GGTACCGCCGCCACCatggcgaccctggaacagctgatgcaggccttcgagtccctcca gtccttccaacagcagcaacagcaacaacagcagcaacagcaacaacagcagcaacagc aacaacagcagcaacaacagc agcaacagcaacaacagcagcaacagcaacaacagca gcagcagcaacaacagcagcaacagcaacaacaacagcagcaacagcaacaacagcagc aacagcaacaacagcagcaacagcaacaacagcagcaacagc aacaaccgccaccgcc gccgccgccgccgccgcctcctcagcttcctcagccgccgccgcaggcacagccgctgc tgcctcagccgcagccgcccccgccgccgcccccgccgccacccggcccggctgtggct gaggagccgctg caccgaccaggatcctgataaTCTAGA
  | 
 
	| Cloning Information | 
	 | 
 
                                                                
                                                                
                                                             
                                                         
                                                     
                                                 
                                                
                                                    
                                                        
                                                            
                                                            
                                                            
                                                                
	| Remarks | 
	DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 72 polyglutamine repeats and K6Q, K9Q, K15Q mutations | 
 
                                                                
                                                             
                                                            
                                                            
                                                         
                                                     
                                                 
                                                
                                                
                                                
                                                
                                                    
                                                        
                                                            
                                                            
                                                                
	| DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 72 polyglutamine repeats and K6Q, K9Q, K15Q mutations | 
 
	| Remarks | 
	DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 72 polyglutamine repeats and K6Q, K9Q, K15Q mutations | 
 
	| PDF | 
	Vector Map | 
 
	 | 
	Plasmid Collection Screening and Propagation | 
 
	| Supplement | 
	- | 
 
                                                                
                                                                
                                                             
                                                         
                                                     
                                                 
                                             
                                         
                                     
                                 
                                
                             
                         
                     
                 | 
                
                    
                        
                        
                     |